vrnaalifoldpf

 

Function

RNA alignment folding with partition

Description

This is a port of the Vienna RNA package program RNAalifold.

The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnaalifoldpf


% vrnaalifoldpf 
RNA alignment folding with partition
Input (aligned) nucleotide sequence set: ecoli6s.fasta
Vienna RNAfold output file [ecoli6s.vrnaalifoldpf]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqset     (Aligned) nucleotide sequence set filename
                                  and optional format, or reference (input
                                  USA)
  [-outfile]           outfile    [*.vrnaalifoldpf] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure contraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string is accepted)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -covariance         float      [1.0] Weight for covariance (Any numeric
                                  value)
   -nspenalty          float      [1.0] Non-compatible sequence penalty (Any
                                  numeric value)
   -endgaps            boolean    [N] Mark end gaps
   -most               boolean    [N] Use most informative sequence algorithm
   -dotoutfile         outfile    [*.vrnaalifoldpf] Vienna dotplot postscript
                                  output file
   -ssoutfile          outfile    [*.vrnaalifoldpf] Vienna structure
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-dotoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
(Aligned) nucleotide sequence set filename and optional format, or reference (input USA) Readable set of sequences Required
[-outfile]
(Parameter 2)
Vienna RNAfold output file Output file <*>.vrnaalifoldpf
Additional (Optional) qualifiers Allowed values Default
(none)
Advanced (Unprompted) qualifiers Allowed values Default
-constraintfile Vienna RNA structure contraints file (optional) Input file Required
-paramfile Vienna RNA parameters file (optional) Input file Required
-temperature Temperature Any numeric value 37.0
-[no]gu Allow GU pairs Boolean value Yes/No Yes
-[no]closegu Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp Allow lonely pairs Boolean value Yes/No Yes
-[no]convert Convert T to U Boolean value Yes/No Yes
-nsbases Non-standard bases Any string is accepted An empty string is accepted
-[no]tetraloop Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-energy Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0
-scale Estimate of ensemble free energy Any numeric value 1.07
-dangles Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2
-covariance Weight for covariance Any numeric value 1.0
-nspenalty Non-compatible sequence penalty Any numeric value 1.0
-endgaps Mark end gaps Boolean value Yes/No No
-most Use most informative sequence algorithm Boolean value Yes/No No
-dotoutfile Vienna dotplot postscript output file Output file <*>.vrnaalifoldpf
-ssoutfile Vienna structure postscript output file Output file <*>.vrnaalifoldpf

Input file format

vrnaalifoldpf reads any normal sequence USAs.

Input files for usage example

File: ecoli6s.fasta

>X01238.1/1-183
AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA
AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AL627277.1/108623-108805
AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA
AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AJ414145.1/90993-91174
AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG
AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA
AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGACGGCA.CC.UCGGAG.AUCC
>U32767.1/6538-6734
.AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA
AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA
AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG
CAGCGGCACUC.UGGGGU.CUUC
>AE006208.1/8365-8185
.AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG
AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA
AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG
CAGCGGCA.UC.UCGGGUUCUUC
>Y00334.1/77-254
CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G
GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA
AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA
CAGCGGCA.CGACCGGGG.AGCU
>AE004317.1/5626-5807
UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A
GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA
AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU
CAACGGCA.UC.CCGGGG.UUC.

Output file format

vrnaalifoldpf outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: ecoli6s.ssps

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: ePS_dot.c,v 1.1 2005/10/13 13:00:44 ajb Exp $, ViennaRNA-1.6
%%CreationDate: Sat Jul 15 12:00:00 2006
%%Title: Rna secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/drawoutline {
  outlinecolor
  newpath
  coor 0 get aload pop 0.8 0 360 arc
  coor {aload pop lineto} forall
  stroke
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
     coor exch 1 sub get aload pop moveto
     coor exch 1 sub get aload pop lineto
  } forall
  stroke
} bind def
% draw bases
/drawbases {
  [] 0 setdash
  seqcolor
  0
  coor {
    aload pop moveto
    dup sequence exch 1 getinterval cshow
    1 add


  [Part of this file has been deleted for brevity]

60 cmark
146 cmark
61 cmark
145 cmark
62 144 1 gmark
62 cmark
144 cmark
63 cmark
143 cmark
64 cmark
142 cmark
65 141 2 gmark
141 cmark
66 cmark
140 cmark
73 135 2 gmark
73 cmark
135 cmark
74 cmark
134 cmark
75 133 1 gmark
75 cmark
133 cmark
76 132 1 gmark
76 cmark
132 cmark
77 cmark
131 cmark
78 130 1 gmark
78 cmark
130 cmark
79 cmark
129 cmark
86 cmark
122 cmark
90 cmark
119 cmark
91 cmark
118 cmark
92 cmark
117 cmark
93 cmark
116 cmark
94 115 2 gmark
156 cmark

% End Annotations
% show it
showpage
end
%%EOF

Graphics File: ecoli6s.ps

[vrnaalifoldpf results]

File: ecoli6s.vrnaalifoldpf

AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC
....(((((((((((.(((..((((((................................(((((((......(((((((...(.((...(((((....................)))))..)))....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).))))))..... (-56.91 = -48.71 +  -8.20) 
....(((((((((({{(((..((((((................................(((((((......(((((((...{.((...(((((....................)))))..)),....)))))))..,.))))))).(((((((((....)))))))))......)))))).)))))).)).))))))..... [-59.30]
 frequency of mfe structure in ensemble 0.0206905

#Alignment section

7 sequences; length of alignment 203
alifold output
   64   142  0 100.0%   0.000 CG:1    GC:4    UG:1    UA:1   
   63   143  0  99.9%   0.002 GC:1    GU:1    UG:1    UA:4   
   74   134  0  99.8%   0.005 GC:3    GU:1    AU:2    UA:1   
   77   131  0 100.0%   0.001 GC:3    GU:2    AU:2   
   10   193  0  99.8%   0.006 GC:2    GU:1    AU:4   
   76   132  1  99.9%   0.003 CG:1    GC:1    GU:2    AU:1    UA:1   
   79   129  0  99.3%   0.032 CG:2    UG:1    UA:4   
   66   140  0  98.3%   0.056 GC:4    GU:1    AU:1    UA:1   
   92   117  0 100.0%   0.000 CG:5    UA:2   
   91   118  0 100.0%   0.001 CG:1    UA:6   
    6   197  0 100.0%   0.001 CG:4    UA:3   
   90   119  0  99.9%   0.003 CG:6    UA:1   
   61   145  0  99.8%   0.005 GC:2    AU:5   
   93   116  0  99.8%   0.007 GC:5    AU:2   
   75   133  1  99.9%   0.003 CG:2    GU:1    UG:3   
    7   196  0 100.0%   0.000 CG:7   
   78   130  1  99.9%   0.010 CG:2    UA:4   
    8   195  0  99.8%   0.007 UG:7   
   62   144  1  99.7%   0.010 GC:1    AU:5   
    9   194  1  99.9%   0.003 GC:6   
   86   122  0  98.0%   0.083 CG:6    UA:1   
   65   141  2  99.1%   0.028 UG:2    UA:3   
   60   146  1  98.4%   0.050 GC:5    AU:1   
  152   165  0  98.0%   0.170 GC:7   
  155   162  0  98.0%   0.170 CG:7   
   85   123  0  97.9%   0.102 GC:7   
  153   164  0  97.9%   0.141 AU:7   
  154   163  0  97.9%   0.142 AU:7   
  151   166  0  97.5%   0.170 UA:7   
    5   198  0  96.3%   0.110 CG:5    AU:2   
  150   167  0  96.2%   0.158 UA:7   
   25   178  0  95.2%   0.329 GC:6    GU:1   
   26   177  0  95.1%   0.319 GC:6    AU:1   
   23   180  1  95.0%   0.199 CG:3    UG:2    UA:1   
   24   179  1  95.0%   0.320 CG:1    GC:1    GU:4   
   22   181  0  93.7%   0.311 GC:7   
  149   168  0  93.7%   0.404 CG:7   
  156   161  0  92.4%   0.322 CG:6    UG:1   
   27   176  1  91.6%   0.277 CG:4    UA:2   
   18   184  0  90.9%   0.490 GC:7   
   73   135  2  88.8%   0.331 CG:3    AU:1    UA:1   


  [Part of this file has been deleted for brevity]

   25    36  0   0.6%   0.518 GC:7    +
   24    37  1   0.6%   0.725 GU:5    AU:1    +
   85   124  0   0.3%   0.462 GC:7    +
  101   107  0   0.3%   0.080 AU:1    --:6    +
   16   188  0   0.3%   0.831 UA:7    +
  102   114  0   0.2%   0.070 CG:1    --:6    +
  103   113  0   0.2%   0.070 UG:1    --:6    +
  104   112  0   0.2%   0.052 CG:1    --:6    +
   34    38  0   0.2%   0.894 CG:7    +
   16    25  0   0.2%   0.927 UG:7    +
  101   110  0   0.2%   0.061 AU:1    --:6    +
   34    43  0   0.2%   0.658 CG:7    +
   38    42  0   0.2%   0.938 GC:7    +
   37    43  0   0.1%   0.727 UG:7    +
  105   111  0   0.1%   0.030 GU:1    --:6    +
  101   106  0   0.1%   0.063 AU:1    --:6    +
  148   152  0   0.1%   0.237 CG:7    +
   35    43  0   0.1%   0.641 CG:7    +
   25    35  0   0.1%   0.629 GC:7    +
   84   126  2   0.1%   0.039 UG:1    AU:3    UA:1    +
  103   114  0   0.1%   0.071 UG:1    --:6    +
  107   114  0   0.1%   0.072 UG:1    --:6    +
   36   169  0   0.1%   0.882 CG:7    +
  156   160  1   0.1%   0.158 CG:5    UG:1    +
  104   113  0   0.1%   0.058 CG:1    --:6    +
   15   188  0   0.1%   0.501 UA:7    +
   35    40  0   0.1%   0.939 CG:7    +
  155   160  1   0.5%   0.136 CG:6    +
   26    35  1   0.5%   0.639 GC:6    +
   81   126  2   0.2%   0.101 GU:4    UG:1    +
   40    47  2   0.2%   0.584 GC:2    GU:3    +
   81   123  1   0.4%   0.129 GC:6    +
   80   124  1   0.4%   0.460 GC:6    +
  151   157  2   0.2%   0.073 UG:2    UA:3    +
   70   135  2   0.2%   0.499 CG:3    UA:2    +
   82   127  1   0.3%   0.077 UA:6    +
   81   125  1   0.3%   0.339 GU:6    +
   19   182  2   0.1%   0.249 CG:3    UA:2    +
   67    72  2   0.1%   0.036 GC:4    GU:1    +
   79   128  2   0.1%   0.028 UG:1    UA:4    +
   81   124  1   0.2%   0.483 GC:6    +
  149   160  1   0.2%   0.141 CG:6    +
   14   191  1   0.1%   0.284 GC:6    +
   26    34  1   0.1%   0.634 GC:6    +
  148   160  1   0.1%   0.241 CG:6    +
   44    49  1   0.1%   0.062 AU:6    +
   39    48  2   0.2%   0.416 AU:5    +
   35   170  2   0.2%   1.006 CG:5    +
   24    36  2   0.1%   0.486 GC:5    +
   20    25  2   0.1%   0.419 CG:5    +
....(((((((((({{(((..((((((................................(((((((......(((((((...{.((...(((((....................)))))..)),....)))))))..,.))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).....

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
einverted Finds DNA inverted repeats
vrnaalifold RNA alignment folding
vrnacofold RNA cofolding
vrnacofoldconc RNA cofolding with concentrations
vrnacofoldpf RNA cofolding with partitioning
vrnadistance RNA distances
vrnaduplex RNA duplex calculation
vrnaeval RNA eval
vrnaevalpair RNA eval with cofold
vrnafold Calculate secondary structures of RNAs
vrnafoldpf Secondary structures of RNAs with partition
vrnaheat RNA melting
vrnainverse RNA sequences matching a structure
vrnalfold Calculate locally stable secondary structures of RNAs
vrnaplot Plot vrnafold output
vrnasubopt Calculate RNA suboptimals

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.

Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments